Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249846

Morpholino Name: lin28a MO2
Synonyms: lin28a2 MO
Target mRNA: lin28a

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGTCTCTTCTATCTGAGGTCAGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25 22/25
genome
MO
5' GCCTGACCTCAGATAGAAGAGACTT 3'
   |||||||||||||||||||||||| 
3' CGGACTGGAGTCTATCTTCTCTGAG 5'
5' GTCTGACCTCAGATAGAAGAGACTG 3'
   | |||||||||||||||||||||| 
3' CGGACTGGAGTCTATCTTCTCTGAG 5'
5' GTCTGACCACAGATAGAAGAGACTT 3'
   | |||||| ||||||||||||||| 
3' CGGACTGGAGTCTATCTTCTCTGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:61361189..61361213 23/25 Sense target lin28a.L
Chr2S:67147090..67147114 22/25 Antisense target lin28a.S
Chr1L:204959259..204959283 21/25 Antisense unknown
tropicalis 10.0 Chr2:77455699..77455723 24/25 Antisense target lin28a
Publications
First: Lin28 proteins are required for germ layer specification in Xenopus., Development 2013                        
Most recent:
View All Papers