Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249845

Morpholino Name: lin28a MO1
Synonyms: lin28a1 MO
Target mRNA: lin28a

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTCTGCCTTGAAGTTGTCCCAGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 23/25
genome
MO
5' AGCTGGGACAACTTCAAGGCAGACC 3'
   |||||||||||||||||||||||||
3' TCGACCCTGTTGAAGTTCCGTCTGG 5'
5' AGCTGGGACAGCTTCAAGGCAGACC 3'
   |||||||||| ||||||||||||||
3' TCGACCCTGTTGAAGTTCCGTCTGG 5'
5' AGCAGGGACAGCTTCAAGGCAGACC 3'
   ||| |||||| ||||||||||||||
3' TCGACCCTGTTGAAGTTCCGTCTGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:58839938..58839962 24/25 Sense target lin28a.L
chr2S:62939445..62939469 23/25 Antisense target lin28a.S
chr2L:4673929..4673953 21/25 Antisense unknown
tropicalis 10.0 Chr2:77456056..77456080 25/25 Antisense target lin28a
Publications
First: Lin28 proteins are required for germ layer specification in Xenopus., Development 2013                        
Most recent:
View All Papers