Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249791

Morpholino Name: jarid2 MO3
Synonyms: Jarid2 MO2b
Target mRNA: jarid2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCCTTTCCTTGCTCATCCTGTTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genome
MO
5' ATACCAGAATGAGCAAGGAAAGGCC 3'
   | | ||| |||||||||||||||||
3' TCTTGTCCTACTCGTTCCTTTCCGG 5'
5' AGAACAGGATGAGCAAGGAAAGGCC 3'
   |||||||||||||||||||||||||
3' TCTTGTCCTACTCGTTCCTTTCCGG 5'
5' ATAACAGGATGAGCAAGGAAAGGCC 3'
   | |||||||||||||||||||||||
3' TCTTGTCCTACTCGTTCCTTTCCGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:97641725..97641749 25/25 Antisense target jarid2.L
Chr6S:78903622..78903646 24/25 Antisense target jarid2.S
Chr1L:221943599..221943623 21/25 Antisense off-target dcc.L
tropicalis 10.0 Chr6:92366046..92366070 22/25 Antisense target jarid2
Publications
First: Jarid2/Jumonji coordinates control of PRC2 enzymatic activity and target gene occupancy in pluripotent cells., Cell 2009  
Most recent:
View All Papers