Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249780

Morpholino Name: irx3 MO1
Synonyms: MOIrx3.2
Target mRNA: irx3

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGTGGGAAGGACATGGTGCAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genome
MO
5' GCTGCACCATGTCCTTCCCACAGCT 3'
   |||||||||||||||||||||||||
3' CGACGTGGTACAGGAAGGGTGTCGA 5'
5' GCTGCACCATGTCCTTCCCACAGCT 3'
   |||||||||||||||||||||||||
3' CGACGTGGTACAGGAAGGGTGTCGA 5'
5' GCTGCACCATGTCCTTCCCACAACT 3'
   |||||||||||||||||||||| ||
3' CGACGTGGTACAGGAAGGGTGTCGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:33778142..33778166 25/25 Sense target irx3.L
Chr4S:24713948..24713972 24/25 Sense target irx3.S
Chr3L:23265588..23265612 21/25 Sense off-target LOC108710783
tropicalis 10.0 Chr4:41854008..41854032 25/25 Sense target irx3
Chr7:106657991..106658015 21/25 Sense off-target LOC116412469
Publications
First: The prepattern transcription factor Irx3 directs nephron segment identity., Genes Dev 2007                  
Most recent: The Xenopus Irx genes are essential for neural patterning and define the border between prethalamus and thalamus through mutual antagonism with the anterior repressors Fezf and Arx., Dev Biol 2009                  
View All Papers