Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249742

Morpholino Name: id3 MO3
Synonyms: miR-219 MO
Target mRNA: id3

Morpholino Type: uncategorized morpholino
Sequence: 5' CAAGAATTGCGTTTGGACAATCAAG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:10934206..10934230 25/25 Sense unknown
Chr8S:32732769..32732793 25/25 Sense unknown
Chr6L:43736714..43736738 21/25 Sense unknown
tropicalis 10.0 Chr8:25809087..25809111 25/25 Sense off-target mir219
Publications
First: FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development., Dev Biol 2010                                                                
Most recent:
View All Papers