Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249733

Morpholino Name: htr3a MO2
Synonyms: xHtr3 MO2
Target mRNA: htr3a

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGATCAGAGTGTTTGCTTTGTCA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TGACAAAGCAAACACTCTGATCTGT 3'
   |||||||||||||||||||||||||
3' ACTGTTTCGTTTGTGAGACTAGACA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:44653745..44653769 25/25 Sense target htr3a.L
Chr4L:44676370..44676394 24/25 Sense off-target LOC108713503
Chr4L:146794148..146794172 22/25 Sense unknown
Chr5L:48840859..48840883 22/25 Sense unknown
Chr4S:85418499..85418523 21/25 Antisense unknown
tropicalis 10.0 Chr2:58185243..58185267 21/25 Antisense off-target sytl5
Publications
First: Serotonin signaling is required for Wnt-dependent GRP specification and leftward flow in Xenopus., Curr Biol 2012                  
Most recent: A novel serotonin-secreting cell type regulates ciliary motility in the mucociliary epidermis of Xenopus tadpoles., Development 2014                          
View All Papers