Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249732

Morpholino Name: htr3a MO1
Synonyms: xHtr3 MO1
Target mRNA: htr3a

Morpholino Type: uncategorized morpholino
Sequence: 5' GATGTTAAGTGTAGAGTCATTCTGG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CCAGAATGACTCTACACTTAACATC 3'
   |||||||||||||||||||||||||
3' GGTCTTACTGAGATGTGAATTGTAG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:44653718..44653742 25/25 Sense target htr3a.L
Chr4L:44676343..44676367 25/25 Sense off-target LOC108713503
Chr4S:33335564..33335588 24/25 Sense off-target LOC108714962
Chr2L:49683001..49683025 21/25 Sense off-target rap1gap2.L
Chr4L:44616477..44616501 21/25 Sense off-target LOC108713502
Chr4L:44574656..44574680 25/25 Sense unknown
Chr4S:33389780..33389804 25/25 Sense unknown
Publications
First: Serotonin signaling is required for Wnt-dependent GRP specification and leftward flow in Xenopus., Curr Biol 2012                  
Most recent: A novel serotonin-secreting cell type regulates ciliary motility in the mucociliary epidermis of Xenopus tadpoles., Development 2014                          
View All Papers