Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249711

Morpholino Name: hmgn2 MO1
Synonyms: HMGN2 antisense oligo
Target mRNA: hmgn2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTTTCTCTTGGGCATTGTTGGCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genome
MO
5' CAAGCAACAATGCCCAAGAGAAAGG 3'
   ||  |||||||||||||||||||||
3' GTCGGTTGTTACGGGTTCTCTTTCC 5'
5' CAACCAACAATGCCCAAGAGAAAGG 3'
   || ||||||||||||||||||||||
3' GTCGGTTGTTACGGGTTCTCTTTCC 5'
5' CAGCCAACAATGCCCAAGAGAAAGG 3'
   |||||||||||||||||||||||||
3' GTCGGTTGTTACGGGTTCTCTTTCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:67217460..67217484 25/25 Antisense target hmgn2.S
Chr2L:61308399..61308423 24/25 Sense target hmgn2.L
Chr4S:78539690..78539714 21/25 Sense off-target astn1.S
tropicalis 10.0 Chr2:77509483..77509507 23/25 Antisense target hmgn2
Chr6:27340393..27340417 21/25 Sense off-target nebl
Chr7:46865140..46865164 21/25 Antisense off-target unc5b
Publications
First: Developmental role of HMGN proteins in Xenopus laevis., Mech Dev 2003    
Most recent:
View All Papers