Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249708

Morpholino Name: hmgb3 MO1
Synonyms: Hmgb3 MO, Xhmgb3 MO
Target mRNA: hmgb3

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTCTTAGGGTCACGTTTAGCCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genome
MO
5' GATGGCTAAAGGTGACCCTAAGAAG 3'
   |||||||||| ||||||||||||||
3' CTACCGATTTGCACTGGGATTCTTC 5'
5' GATGGCTAAAGGTGACCCTAAGAAG 3'
   |||||||||| ||||||||||||||
3' CTACCGATTTGCACTGGGATTCTTC 5'
5' GATGGCTAAACGTGACCCTAAGAAG 3'
   |||||||||||||||||||||||||
3' CTACCGATTTGCACTGGGATTCTTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:66589136..66589160 25/25 Antisense target hmgb3.S
Chr8L:49899634..49899658 24/25 Antisense target hmgb3.L
tropicalis 10.0 Chr8:58157999..58158023 24/25 Antisense target hmgb3
Publications
First: Nucleosome regulator Xhmgb3 is required for cell proliferation of the eye and brain as a downstream target of Xenopus rax/Rx1., Dev Biol 2006            
Most recent: Sumoylation controls retinal progenitor proliferation by repressing cell cycle exit in Xenopus laevis., Dev Biol 2010                                                    
View All Papers