Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249690

Morpholino Name: hesx1 MO2
Synonyms: Xanf MO, anti-Xanf, anti-Xanf1 MO
Target mRNA: hesx1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCCTTTCTGAAGAGCAGGAGACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genome
MO
5' ATGTCTCCTGGTCTTCAGAAAGGAT 3' |||||||||| |||||||||||||| 3' TACAGAGGACGAGAAGTCTTTCCTA 5' 5' ATGTCTCCTGCTCTTCAGAAAGGAT 3' ||||||||||||||||||||||||| 3' TACAGAGGACGAGAAGTCTTTCCTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:150330982..150331006 25/25 Antisense target hesx1.L
Chr5L:101611995..101612019 22/25 Antisense off-target LOC108716177
Chr1L:147072510..147072534 21/25 Antisense off-target ercc6l2.L
Chr2L:26750355..26750379 22/25 unknown
Chr8S:31855341..31855365 21/25 unknown
Chr2L:38443167..38443191 21/25 unknown
tropicalis 10.0 Chr4:148686779..148686803 24/25 Antisense target hesx1
Chr4:128018293..128018317 21/25 Sense off-target grm2
Chr4:104447478..104447502 21/25 unknown
Publications
First: Multiple noggins in vertebrate genome: cloning and expression of noggin2 and noggin4 in Xenopus laevis., Gene Expr Patterns 2006                
Most recent: The homeodomain factor Xanf represses expression of genes in the presumptive rostral forebrain that specify more caudal brain regions., Dev Biol 2007          
View All Papers