Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249688

Morpholino Name: hes5.7 MO2
Synonyms: esr9, hes9.1 MO2
Target mRNA: hes5.7

Morpholino Type: translation blocking morpholino
Sequence: 5' CTGTCTGGTAATGGGATGTGATGGA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TCCATCACATCCCATTACCAGACAG 3'
   |||||||||||||||||||||||||
3' AGGTAGTGTAGGGTAATGGTCTGTC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:104067972..104067996 25/25 Antisense target hes5.7.L
Chr7L:104056890..104056914 25/25 Antisense off-target hes5.6.L
Chr7L:104051070..104051094 24/25 Antisense off-target hes5.5.L
Chr8S:86497223..86497247 22/25 Sense unknown
tropicalis 10.0 Chr7:99528174..99528198 22/25 Antisense off-target LOC116412194
Chr4:2124873..2124897 22/25 Antisense off-target LOC100485132
Chr5:123632531..123632555 21/25 Antisense off-target spsb4
Chr8:81055733..81055757 22/25 Sense unknown
Publications
First: The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen., Development 2006                    
Most recent:
View All Papers