Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249686

Morpholino Name: hes7.2 MO1
Synonyms: Esr4
Target mRNA: hes7.2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCTGCTCTGTGTGAGGAGAAAGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GACTTTCTCCTCACACAGAGCAGAT 3'
   |||||||||||||||||||||||||
3' CTGAAAGAGGAGTGTGTCTCGTCTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:80408607..80408631 21/25 Antisense off-target aff1.L
chr1S:90825303..90825327 21/25 Antisense off-target LOC108704770 [provisional:polrmt]
chr1S:3125839..3125863 21/25 Sense unknown
chr5S:11162748..11162772 21/25 Sense unknown
chr6L:154016364..154016388 21/25 Sense unknown
tropicalis 10.0 Chr3:144601207..144601231 25/25 Sense target hes7.2
Chr2:141967697..141967721 21/25 Sense off-target avil
Chr1:216470481..216470505 21/25 Sense off-target LOC100490559
Publications
First: Microarray-based identification of VegT targets in Xenopus., Mech Dev 2005                                            
Most recent:
View All Papers