Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249684

Morpholino Name: hes7.1 MO1
Synonyms: XHR1-MO3
Target mRNA: hes7.1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTAAGATGATGATGACGATGATGA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 23/25
genome
MO
5' TCTTCATCATCATCATCATCTTACC 3'
   || ||||| ||||||||||||||||
3' AGTAGTAGCAGTAGTAGTAGAATGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 7.1 Scaffold193742:401957..401981 23/25 Antisense target hes7.1.L
Scaffold267727:1026270..1026294 23/25 Antisense off-target mecom.S
Scaffold120166:25073..25097 23/25 Antisense off-target Xelaev16005157m
Scaffold20641:1844074..1844098 23/25 Antisense off-target Xelaev16026596m
Scaffold315413:1181478..1181502 23/25 Antisense off-target Xelaev16042258m
Scaffold48253:2049423..2049447 23/25 Antisense off-target Xelaev16057566m
Scaffold293841:208456..208480 22/25 Antisense off-target ptma.L
Scaffold51452:2202310..2202334 22/25 Antisense off-target prlr.S
Scaffold303743:309053..309077 22/25 Antisense off-target mfap2.L
Scaffold67962:1768243..1768267 22/25 Antisense off-target ptprf.L
Scaffold38656:1037237..1037261 22/25 Antisense off-target mtmr10.S
Scaffold51654:1163092..1163116 22/25 Antisense off-target phactr1.S
Scaffold78978:4627362..4627386 22/25 Antisense off-target rangap1.L
Scaffold109621:130789..130813 22/25 Antisense off-target Xelaev16002537m
Scaffold1168:1308781..1308805 22/25 Antisense off-target Xelaev16004484m
Scaffold1187:2777510..2777534 22/25 Antisense off-target Xelaev16004820m
Scaffold12518:658952..658976 22/25 Antisense off-target Xelaev16006926m
Scaffold160942:3674357..3674381 22/25 Antisense off-target Xelaev16017694m
Scaffold169011:184300..184324 22/25 Antisense off-target Xelaev16020054m
Scaffold187321:3420095..3420119 22/25 Antisense off-target Xelaev16023366m
Scaffold22011:245430..245454 22/25 Antisense off-target Xelaev16028532m
Scaffold220448:1571124..1571148 22/25 Antisense off-target Xelaev16028600m
Scaffold236382:3495649..3495673 22/25 Antisense off-target Xelaev16031458m
Scaffold26505:1635566..1635590 22/25 Antisense off-target Xelaev16035539m
Scaffold36364:2295441..2295465 22/25 Antisense off-target Xelaev16047330m
Scaffold39604:460968..460992 22/25 Antisense off-target Xelaev16050327m
Scaffold53445:46926..46950 22/25 Antisense off-target Xelaev16061324m
Scaffold71264:3230632..3230656 22/25 Antisense off-target Xelaev16070004m
Scaffold82102:4191132..4191156 22/25 Antisense off-target Xelaev16075165m
Scaffold287959:2798036..2798060 21/25 Antisense off-target cbl.L
Scaffold356308:127442..127466 21/25 Antisense off-target was.L
Scaffold45774:2085046..2085070 21/25 Antisense off-target ncl.S
Scaffold939:3926972..3926996 21/25 Antisense off-target srl.L
Scaffold102974:20119461..20119485 21/25 Antisense off-target rtn4.L
Scaffold14978:7703094..7703118 21/25 Antisense off-target vwa8.L
Scaffold30711:611309..611333 21/25 Antisense off-target mtf1.L
Scaffold34503:1513795..1513819 21/25 Antisense off-target gdf6.S
Scaffold97342:487793..487817 21/25 Antisense off-target npm1.L
Scaffold33104:2256195..2256219 21/25 Antisense off-target srpk3.S
Scaffold3467:3888090..3888114 21/25 Antisense off-target fgfr3.L
Scaffold347078:786182..786206 21/25 Antisense off-target casq2.S
Scaffold36991:2698722..2698746 21/25 Antisense off-target efnb1.L
Scaffold387025:8844..8868 21/25 Antisense off-target gon4l.L
Scaffold41091:1181929..1181953 21/25 Antisense off-target casq1.S
Scaffold52441:12654056..12654080 21/25 Antisense off-target dhx29.L
Scaffold54194:5659..5683 21/25 Antisense off-target cdhr5.S
Scaffold56125:1684419..1684443 21/25 Antisense off-target paqr3.S
Scaffold70222:123465..123489 21/25 Antisense off-target stat6.L
Scaffold79772:2439364..2439388 21/25 Antisense off-target bicc1.L
Scaffold8129:7591838..7591862 21/25 Antisense off-target nabp2.S
Scaffold27038:1276644..1276668 21/25 Antisense off-target cdc25b.L
Scaffold58049:5448838..5448862 21/25 Antisense off-target anp32a.L
Scaffold9994:2811624..2811648 21/25 Antisense off-target cpped1.L
Scaffold50694:6274431..6274455 21/25 Antisense off-target bloc1s3.S
Scaffold103899:302402..302426 21/25 Antisense off-target Xelaev16001061m
Scaffold11701:549795..549819 21/25 Antisense off-target Xelaev16004612m
Scaffold12462:1156890..1156914 21/25 Antisense off-target Xelaev16006676m
Scaffold128184:314693..314717 21/25 Antisense off-target Xelaev16007951m
Scaffold129797:2217164..2217188 21/25 Antisense off-target Xelaev16008564m
Scaffold130324:1111414..1111438 21/25 Antisense off-target Xelaev16008670m
Scaffold13265:2039481..2039505 21/25 Antisense off-target Xelaev16009266m
Scaffold133814:1797277..1797301 21/25 Antisense off-target Xelaev16009874m
Scaffold13787:3009756..3009780 21/25 Antisense off-target Xelaev16011647m
Scaffold14557:804874..804898 21/25 Antisense off-target Xelaev16013187m
Scaffold149581:2509852..2509876 21/25 Antisense off-target Xelaev16014171m
Scaffold164049:1584132..1584156 21/25 Antisense off-target Xelaev16018558m
Scaffold16807:11153171..11153195 21/25 Antisense off-target Xelaev16019664m
Scaffold175714:469740..469764 21/25 Antisense off-target Xelaev16021148m
Scaffold176303:115249..115273 21/25 Antisense off-target Xelaev16021317m
Scaffold18192:727581..727605 21/25 Antisense off-target Xelaev16022406m
Scaffold207705:321043..321067 21/25 Antisense off-target Xelaev16026889m
Scaffold221007:2870749..2870773 21/25 Antisense off-target Xelaev16028812m
Scaffold230826:4181330..4181354 21/25 Antisense off-target Xelaev16030012m
Scaffold23301:138187..138211 21/25 Antisense off-target Xelaev16030576m
Scaffold24606:42292..42316 21/25 Antisense off-target Xelaev16032949m
Scaffold25194:1018313..1018337 21/25 Antisense off-target Xelaev16033585m
Scaffold268161:25552..25576 21/25 Antisense off-target Xelaev16036158m
Scaffold272406:3392599..3392623 21/25 Antisense off-target Xelaev16037453m
Scaffold294734:750964..750988 21/25 Antisense off-target Xelaev16039507m
Scaffold30581:238813..238837 21/25 Antisense off-target Xelaev16041313m
Scaffold32212:7037584..7037608 21/25 Antisense off-target Xelaev16042895m
Scaffold34423:2813004..2813028 21/25 Antisense off-target Xelaev16045023m
Scaffold356123:772439..772463 21/25 Antisense off-target Xelaev16046662m
Scaffold36401:1900450..1900474 21/25 Antisense off-target Xelaev16047469m
Scaffold39723:1139905..1139929 21/25 Antisense off-target Xelaev16050543m
Scaffold402161:259273..259297 21/25 Antisense off-target Xelaev16051437m
Scaffold40886:138151..138175 21/25 Antisense off-target Xelaev16051855m
Scaffold4321:11499885..11499909 21/25 Antisense off-target Xelaev16053157m
Scaffold43242:11315538..11315562 21/25 Antisense off-target Xelaev16053604m
Scaffold43791:2916337..2916361 21/25 Antisense off-target Xelaev16054152m
Scaffold44247:32222..32246 21/25 Antisense off-target Xelaev16054472m
Scaffold44494:3219390..3219414 21/25 Antisense off-target Xelaev16054620m
Scaffold45965:2524263..2524287 21/25 Antisense off-target Xelaev16055595m
Scaffold45985:272707..272731 21/25 Antisense off-target Xelaev16055616m
Scaffold47026:117130..117154 21/25 Antisense off-target Xelaev16056393m
Scaffold47457:763893..763917 21/25 Antisense off-target Xelaev16056755m
Scaffold50079:4857548..4857572 21/25 Antisense off-target Xelaev16058263m
Scaffold5370:838321..838345 21/25 Antisense off-target Xelaev16061460m
Scaffold5375:926417..926441 21/25 Antisense off-target Xelaev16061564m
Scaffold54274:1245310..1245334 21/25 Antisense off-target Xelaev16061765m
Scaffold58517:4302463..4302487 21/25 Antisense off-target Xelaev16063979m
Scaffold58784:146383..146407 21/25 Antisense off-target Xelaev16064014m
Scaffold59883:3639742..3639766 21/25 Antisense off-target Xelaev16065346m
Scaffold60945:294284..294308 21/25 Antisense off-target Xelaev16065811m
Scaffold61078:578367..578391 21/25 Antisense off-target Xelaev16065838m
Scaffold68269:321755..321779 21/25 Antisense off-target Xelaev16068456m
Scaffold69443:5176335..5176359 21/25 Antisense off-target Xelaev16068888m
Scaffold7331:1851263..1851287 21/25 Antisense off-target Xelaev16070669m
Scaffold74352:427210..427234 21/25 Antisense off-target Xelaev16070921m
Scaffold74750:44639..44663 21/25 Antisense off-target Xelaev16071359m
Scaffold75417:2346184..2346208 21/25 Antisense off-target Xelaev16071833m
Scaffold7555:875912..875936 21/25 Antisense off-target Xelaev16072373m
Scaffold83691:1435264..1435288 21/25 Antisense off-target Xelaev16075680m
Scaffold85380:979..1003 21/25 Antisense off-target Xelaev16076021m
Scaffold86880:35479..35503 21/25 Antisense off-target Xelaev16076713m
Scaffold8828:633844..633868 21/25 Antisense off-target Xelaev16077165m
Scaffold89040:2017361..2017385 21/25 Antisense off-target Xelaev16077660m
Scaffold9266:11838779..11838803 21/25 Antisense off-target Xelaev16078925m
Scaffold93635:178523..178547 21/25 Antisense off-target Xelaev16079090m
Scaffold93786:1723669..1723693 21/25 Antisense off-target Xelaev16079186m
Scaffold98463:818136..818160 21/25 Antisense off-target Xelaev16080573m
Scaffold2409:534392..534416 23/25 Antisense unknown
Scaffold63696:368303..368327 23/25 Antisense unknown
Scaffold13523:5055444..5055468 22/25 Antisense unknown
Scaffold135348:1623447..1623471 22/25 Antisense unknown
Scaffold14692:1840901..1840925 22/25 Antisense unknown
Scaffold159287:866146..866170 22/25 Antisense unknown
Scaffold162275:352..376 22/25 Antisense unknown
Scaffold162385:85336..85360 22/25 Antisense unknown
Scaffold181837:709913..709937 22/25 Antisense unknown
Scaffold220408:73..97 22/25 Antisense unknown
Scaffold247724:201036..201060 22/25 Antisense unknown
Scaffold286106:43..67 22/25 Antisense unknown
Scaffold325719:5..29 22/25 Antisense unknown
Scaffold373399:2046538..2046562 22/25 Antisense unknown
Scaffold404817:302203..302227 22/25 Antisense unknown
Scaffold48687:497551..497575 22/25 Antisense unknown
Scaffold5269:1004388..1004412 22/25 Antisense unknown
Scaffold6546:723460..723484 22/25 Antisense unknown
Scaffold82610:768139..768163 22/25 Antisense unknown
Scaffold102068:512163..512187 21/25 Antisense unknown
Scaffold106789:2291253..2291277 21/25 Antisense unknown
Scaffold108224:1095335..1095359 21/25 Antisense unknown
Scaffold109418:1292645..1292669 21/25 Antisense unknown
Scaffold112535:197..221 21/25 Antisense unknown
Scaffold11605:11311..11335 21/25 Antisense unknown
Scaffold12020:13675462..13675486 21/25 Antisense unknown
Scaffold12423:1188368..1188392 21/25 Antisense unknown
Scaffold124774:1065414..1065438 21/25 Antisense unknown
Scaffold13204:1643111..1643135 21/25 Antisense unknown
Scaffold1391:2036794..2036818 21/25 Antisense unknown
Scaffold142445:2041422..2041446 21/25 Antisense unknown
Scaffold143831:2296553..2296577 21/25 Antisense unknown
Scaffold144508:133807..133831 21/25 Antisense unknown
Scaffold149890:3407436..3407460 21/25 Antisense unknown
Scaffold15893:3951696..3951720 21/25 Antisense unknown
Scaffold16001:4693231..4693255 21/25 Antisense unknown
Scaffold160841:2794009..2794033 21/25 Antisense unknown
Scaffold163806:5158706..5158730 21/25 Antisense unknown
Scaffold16424:75662..75686 21/25 Antisense unknown
Scaffold167265:2111884..2111908 21/25 Antisense unknown
Scaffold16863:6911142..6911166 21/25 Antisense unknown
Scaffold169907:195483..195507 21/25 Antisense unknown
Scaffold175547:3194921..3194945 21/25 Antisense unknown
Scaffold18184:3346963..3346987 21/25 Antisense unknown
Scaffold1915:1103242..1103266 21/25 Antisense unknown
Scaffold193187:102720..102744 21/25 Antisense unknown
Scaffold195950:1488417..1488441 21/25 Antisense unknown
Scaffold200825:2937803..2937827 21/25 Antisense unknown
Scaffold202158:2050259..2050283 21/25 Antisense unknown
Scaffold203187:1001016..1001040 21/25 Antisense unknown
Scaffold203280:897619..897643 21/25 Antisense unknown
Scaffold206536:280..304 21/25 Antisense unknown
Scaffold21603:7797419..7797443 21/25 Antisense unknown
Scaffold218195:625364..625388 21/25 Antisense unknown
Scaffold22127:4450610..4450634 21/25 Antisense unknown
Scaffold222217:49584..49608 21/25 Antisense unknown
Scaffold23403:11065376..11065400 21/25 Antisense unknown
Scaffold235536:25..49 21/25 Antisense unknown
Scaffold237598:426106..426130 21/25 Antisense unknown
Scaffold239343:607..631 21/25 Antisense unknown
Scaffold24235:1558920..1558944 21/25 Antisense unknown
Scaffold246008:277..301 21/25 Antisense unknown
Scaffold25254:563615..563639 21/25 Antisense unknown
Scaffold255210:311..335 21/25 Antisense unknown
Scaffold255257:998397..998421 21/25 Antisense unknown
Scaffold256647:1840977..1841001 21/25 Antisense unknown
Scaffold258556:431..455 21/25 Antisense unknown
Scaffold26364:1246194..1246218 21/25 Antisense unknown
Scaffold266756:433774..433798 21/25 Antisense unknown
Scaffold27036:4816137..4816161 21/25 Antisense unknown
Scaffold27115:378118..378142 21/25 Antisense unknown
Scaffold272282:284..308 21/25 Antisense unknown
Scaffold273432:2843..2867 21/25 Antisense unknown
Scaffold275342:2509984..2510008 21/25 Antisense unknown
Scaffold2874:92..116 21/25 Antisense unknown
Scaffold289035:10140..10164 21/25 Antisense unknown
Scaffold29621:1838409..1838433 21/25 Antisense unknown
Scaffold29869:530049..530073 21/25 Antisense unknown
Scaffold29940:1676010..1676034 21/25 Antisense unknown
Scaffold30080:1283760..1283784 21/25 Antisense unknown
Scaffold302461:159..183 21/25 Antisense unknown
Scaffold30470:2052148..2052172 21/25 Antisense unknown
Scaffold308427:856..880 21/25 Antisense unknown
Scaffold30987:1509533..1509557 21/25 Antisense unknown
Scaffold31469:1182587..1182611 21/25 Antisense unknown
Scaffold316228:154..178 21/25 Antisense unknown
Scaffold316819:32..56 21/25 Antisense unknown
Scaffold329983:154..178 21/25 Antisense unknown
Scaffold33269:163796..163820 21/25 Antisense unknown
Scaffold35524:3476773..3476797 21/25 Antisense unknown
Scaffold357936:198..222 21/25 Antisense unknown
Scaffold367645:101..125 21/25 Antisense unknown
Scaffold374157:151..175 21/25 Antisense unknown
Scaffold376268:78..102 21/25 Antisense unknown
Scaffold379358:26..50 21/25 Antisense unknown
Scaffold387661:602..626 21/25 Antisense unknown
Scaffold3881:892671..892695 21/25 Antisense unknown
Scaffold393432:75..99 21/25 Antisense unknown
Scaffold394073:3481..3505 21/25 Antisense unknown
Scaffold39431:499881..499905 21/25 Antisense unknown
Scaffold42960:4939093..4939117 21/25 Antisense unknown
Scaffold43061:1723774..1723798 21/25 Antisense unknown
Scaffold44546:772709..772733 21/25 Antisense unknown
Scaffold44863:269955..269979 21/25 Antisense unknown
Scaffold45400:233487..233511 21/25 Antisense unknown
Scaffold46492:1238717..1238741 21/25 Antisense unknown
Scaffold47533:4527202..4527226 21/25 Antisense unknown
Scaffold47606:2828706..2828730 21/25 Antisense unknown
Scaffold47683:3983417..3983441 21/25 Antisense unknown
Scaffold49409:13826..13850 21/25 Antisense unknown
Scaffold51988:2151463..2151487 21/25 Antisense unknown
Scaffold52170:115987..116011 21/25 Antisense unknown
Scaffold52487:287067..287091 21/25 Antisense unknown
Scaffold52573:12278740..12278764 21/25 Antisense unknown
Scaffold52702:8860143..8860167 21/25 Antisense unknown
Scaffold53263:248515..248539 21/25 Antisense unknown
Scaffold54899:274089..274113 21/25 Antisense unknown
Scaffold56777:1925544..1925568 21/25 Antisense unknown
Scaffold57180:3469065..3469089 21/25 Antisense unknown
Scaffold5732:3687074..3687098 21/25 Antisense unknown
Scaffold57559:1738221..1738245 21/25 Antisense unknown
Scaffold5925:10766544..10766568 21/25 Antisense unknown
Scaffold60518:1134707..1134731 21/25 Antisense unknown
Scaffold61741:2681052..2681076 21/25 Antisense unknown
Scaffold62432:34361..34385 21/25 Antisense unknown
Scaffold65414:1338279..1338303 21/25 Antisense unknown
Scaffold6590:2015763..2015787 21/25 Antisense unknown
Scaffold67738:768779..768803 21/25 Antisense unknown
Scaffold678:191703..191727 21/25 Antisense unknown
Scaffold68908:309516..309540 21/25 Antisense unknown
Scaffold6891:104191..104215 21/25 Antisense unknown
Scaffold7045:2973005..2973029 21/25 Antisense unknown
Scaffold70754:44318..44342 21/25 Antisense unknown
Scaffold7103:1602287..1602311 21/25 Antisense unknown
Scaffold74339:837642..837666 21/25 Antisense unknown
Scaffold7546:1399915..1399939 21/25 Antisense unknown
Scaffold78860:3984810..3984834 21/25 Antisense unknown
Scaffold8276:712344..712368 21/25 Antisense unknown
Scaffold83323:154242..154266 21/25 Antisense unknown
Scaffold84303:1415868..1415892 21/25 Antisense unknown
Scaffold86352:984735..984759 21/25 Antisense unknown
Scaffold86871:10582..10606 21/25 Antisense unknown
Scaffold86967:806506..806530 21/25 Antisense unknown
Scaffold89111:124..148 21/25 Antisense unknown
Scaffold90041:4498165..4498189 21/25 Antisense unknown
Scaffold91950:297924..297948 21/25 Antisense unknown
Scaffold93052:143868..143892 21/25 Antisense unknown
Scaffold94859:669749..669773 21/25 Antisense unknown
Scaffold96659:6885544..6885568 21/25 Antisense unknown
Scaffold99286:3821298..3821322 21/25 Antisense unknown
Publications
First: Identification of target genes for the Xenopus Hes-related protein XHR1, a prepattern factor specifying the midbrain-hindbrain boundary., Dev Biol 2005                      
Most recent:
View All Papers