Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249683

Morpholino Name: hes6.1 MO2
Synonyms: Xhes6 MO-2, Xhes6 morpholino
Target mRNA: hes6.1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGGTAGATGAATAAGGACACACG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CGTGTGTCCTTATTCATCTACCATG 3'
   |||||||||||||||||||||||||
3' GCACACAGGAATAAGTAGATGGTAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:137645885..137645909 25/25 Sense target hes6.1.L
Chr8L:10696337..10696361 21/25 Antisense off-target LOC121397101
Publications
First: Hes6 is required for MyoD induction during gastrulation., Dev Biol 2007              
Most recent: Hes6 is required for the neurogenic activity of neurogenin and NeuroD., PLoS One 2011                
View All Papers