Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249681

Morpholino Name: hes5.1 MO1
Synonyms: ESR1 MO
Target mRNA: hes5

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGGTAGGAGCCATTATCCTAAGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 25/25
genome
MO
5' ACTTTGGATCATGGCTCCTACCAGC 3'
   |||| |||| |||||||||||||||
3' TGAATCCTATTACCGAGGATGGTCG 5'
5' ACTTAGGATAATGGCTCCTACCAGC 3'
   |||||||||||||||||||||||||
3' TGAATCCTATTACCGAGGATGGTCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:92316574..92316598 25/25 Antisense target hes5.1.L
Chr7S:78361351..78361375 23/25 Antisense target hes5.1.S
Chr1L:82711245..82711269 21/25 Sense unknown
Chr9_10S:65246265..65246289 21/25 Sense unknown
tropicalis 10.0 Chr7:90022930..90022954 23/25 Antisense target hes5.1
Chr4:32136971..32136995 22/25 Sense off-target slc22a8
Chr2:531844..531868 21/25 Sense unknown
Publications
First: BCL6 canalizes Notch-dependent transcription, excluding Mastermind-like1 from selected target genes during left-right patterning., Dev Cell 2010          
Most recent:
View All Papers