Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249675

Morpholino Name: hes2 MO1
Synonyms: XHes2
Target mRNA: hes2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGACTAGGCAGCGGTGCTTCCAG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CTGGAAGCACCGCTGCCTAGTCTGT 3'
   |||||||||||||||||||||||||
3' GACCTTCGTGGCGACGGATCAGACA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:103534721..103534745 25/25 Sense target hes2.L
tropicalis 10.0 Chr4:82018271..82018295 21/25 Sense off-target negr1
Publications
First: Characterization and function of the bHLH-O protein XHes2: insight into the mechanisms controlling retinal cell fate decision., Development 2006                  
Most recent:
View All Papers