Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249669

Morpholino Name: has1 MO1
Synonyms: Has1-Mo1
Target mRNA: has1

Morpholino Type: uncategorized morpholino
Sequence: 5' CACACACATGGGATATGCCAAGTTT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' AAACTTGGCATATCCCATGTGTGTG 3'
   |||||||||||||||||||||||||
3' TTTGAACCGTATAGGGTACACACAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:1590697..1590721 25/25 Antisense target has1.S
Chr2L:81043548..81043572 21/25 Antisense unknown
tropicalis 10.0 Chr10:5230345..5230369 21/25 Sense off-target c20orf85
Publications
First: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
Most recent:
View All Papers