Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249665

Morpholino Name: h3-3a MO2
Synonyms: H3 MO2, h3f3a MO2
Target mRNA: h3-3a

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GCGGTCTGCTTGGTACGAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 21/23
genome
MO
5' ATGGCCCGTACCAAGCAGACAGC 3'
   ||||| |||||||||||||| ||
3' TACCGAGCATGGTTCGTCTGGCG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:114510049..114510071 23/23 Sense off-target XB5772961.L
Chr9_10S:114859489..114859511 23/23 Antisense off-target XB5772961.L
Chr3S:120616207..120616229 23/23 Antisense off-target LOC121402047
Chr3S:120616207..120616229 23/23 Antisense off-target LOC121402225
Chr3S:124252901..124252923 23/23 Sense off-target LOC121402271
Chr6S:2325761..2325783 23/23 Sense off-target LOC108695504
Chr6S:2325761..2325783 23/23 Sense off-target LOC108695575
Chr9_10L:134989801..134989823 23/23 Antisense off-target LOC121398065
Chr9_10L:135155764..135155786 23/23 Antisense off-target LOC108703790
Chr9_10S:114510049..114510071 23/23 Sense off-target LOC108704314
Chr9_10S:114510049..114510071 23/23 Sense off-target LOC108704296
Chr9_10S:114859489..114859511 23/23 Antisense off-target LOC108704298
Chr5S:6159798..6159820 22/23 Antisense off-target h3c8.S
Chr5S:6754871..6754893 22/23 Sense off-target LOC121394152
Chr5S:6754871..6754893 22/23 Sense off-target LOC108717648
Chr5S:6767968..6767990 22/23 Sense off-target LOC121394151
Chr9_10L:134245868..134245890 22/23 Antisense off-target LOC121398067
Chr9_10L:134254209..134254231 22/23 Sense off-target LOC108703785
Chr9_10S:114097543..114097565 22/23 Antisense off-target LOC108704306
Chr9_10S:114184881..114184903 22/23 Sense off-target LOC121399124
Chr9_10S:114185285..114185307 22/23 Antisense off-target LOC121399123
Chr5S:12195926..12195948 21/23 Sense off-target h3-5.L
Chr9_10L:47331708..47331730 21/23 Sense off-target h3-3b.L
Chr9_10S:94026058..94026080 21/23 Sense off-target h3c13.S
Chr5L:17923214..17923236 21/23 Antisense off-target LOC108716488
Chr9_10L:107985151..107985173 21/23 Sense off-target LOC108701569
Chr5L:23908056..23908078 21/23 Antisense off-target LOC108716540
Chr5L:23950854..23950876 21/23 Antisense off-target LOC121393613
Chr5L:23965735..23965757 21/23 Antisense off-target LOC108705669
Chr5L:23994635..23994657 21/23 Antisense off-target LOC108705672
Chr9_10L:134318614..134318636 21/23 Antisense off-target LOC121398066
Chr9_10L:134388307..134388329 21/23 Antisense off-target LOC121398063
Chr9_10L:134394367..134394389 21/23 Antisense off-target LOC108716541
Chr9_10L:134546238..134546260 21/23 Sense off-target LOC121398064
Chr9_10L:134559424..134559446 21/23 Sense off-target LOC121398064
Chr2S:14968261..14968283 20/23 Antisense off-target crybg3.S
Chr3S:120630304..120630326 23/23 Antisense unknown
Chr3S:120644395..120644417 23/23 Antisense unknown
Chr3S:120658789..120658811 23/23 Antisense unknown
Chr3S:120672880..120672902 23/23 Antisense unknown
Chr3S:123419798..123419820 23/23 Antisense unknown
Chr3S:123433393..123433415 23/23 Antisense unknown
Chr3S:123454434..123454456 23/23 Antisense unknown
Chr9_10L:135020997..135021019 23/23 Antisense unknown
Chr9_10L:135139651..135139673 23/23 Antisense unknown
Chr3S:123467858..123467880 22/23 Antisense unknown
Chr9_10L:133821108..133821130 22/23 Antisense unknown
Chr9_10L:133833226..133833248 22/23 Antisense unknown
Chr9_10L:135043481..135043503 22/23 Antisense unknown
Chr5L:23892303..23892325 21/23 Antisense unknown
Chr5L:24026396..24026418 21/23 Antisense unknown
tropicalis 10.0 Chr5:8209994..8210016 21/23 Sense target h3-3a
Chr6:4062807..4062829 23/23 Antisense off-target LOC100487179
Chr9:4894194..4894216 22/23 Sense off-target h2aj
Chr9:2727436..2727458 22/23 Sense off-target h3c13
Chr9:3506194..3506216 22/23 Antisense off-target h2ac14
Chr6:4055613..4055635 22/23 Sense off-target LOC116411632
Chr6:4055613..4055635 22/23 Sense off-target LOC101732029
Chr6:4059548..4059570 22/23 Sense off-target LOC101734931
Chr6:4059548..4059570 22/23 Sense off-target LOC101732029
Chr6:4245944..4245966 22/23 Antisense off-target LOC100487139
Chr6:4252503..4252525 22/23 Sense off-target LOC100496027
Chr6:4308192..4308214 22/23 Antisense off-target LOC100486720
Chr6:4852643..4852665 22/23 Sense off-target LOC116411630
Chr6:4852643..4852665 22/23 Sense off-target LOC101733242
Chr6:5109909..5109931 22/23 Antisense off-target LOC100497127
Chr6:5269746..5269768 22/23 Sense off-target LOC116411629
Chr6:5288979..5289001 22/23 Sense off-target LOC100493100
Chr9:2677792..2677814 22/23 Sense off-target LOC101731074
Chr9:2727436..2727458 22/23 Sense off-target LOC100488698
Chr9:2833099..2833121 22/23 Sense off-target LOC101731959
Chr9:2833099..2833121 22/23 Sense off-target LOC108648869
Chr9:2891955..2891977 22/23 Antisense off-target LOC100493036
Chr9:2954381..2954403 22/23 Sense off-target LOC100494884
Chr9:2965515..2965537 22/23 Sense off-target LOC100486653
Chr9:2989983..2990005 22/23 Sense off-target LOC100486653
Chr9:2989983..2990005 22/23 Sense off-target LOC100493706
Chr9:2954381..2954403 22/23 Sense off-target LOC116407589
Chr9:3506194..3506216 22/23 Antisense off-target LOC105945443
Chr9:4257129..4257151 22/23 Antisense off-target LOC116406473
Chr9:4565863..4565885 22/23 Sense off-target LOC100485665
Chr9:4578573..4578595 22/23 Sense off-target LOC105947137
Chr9:4747346..4747368 22/23 Antisense off-target LOC100487628
Chr9:3506194..3506216 22/23 Antisense off-target LOC101730986
Chr9:4747346..4747368 22/23 Antisense off-target LOC116406469
Chr9:4803195..4803217 22/23 Sense off-target LOC100487628
Chr9:4803195..4803217 22/23 Sense off-target LOC108645245
Chr9:5608828..5608850 22/23 Antisense off-target LOC116407737
Chr9:5608828..5608850 22/23 Antisense off-target LOC116407634
Chr9:5615686..5615708 22/23 Antisense off-target LOC116407634
Chr9:4807102..4807124 22/23 Sense off-target LOC100487628
Chr9:4807102..4807124 22/23 Sense off-target LOC101733224
Chr9:4894194..4894216 22/23 Sense off-target LOC101730415
Chr9:4910105..4910127 22/23 Sense off-target LOC116407578
Chr9:4974890..4974912 22/23 Sense off-target LOC100497614
Chr9:4974890..4974912 22/23 Sense off-target LOC116407579
Chr9:4988961..4988983 22/23 Sense off-target LOC100497614
Chr9:5024646..5024668 22/23 Antisense off-target LOC101730642
Chr9:5558102..5558124 22/23 Antisense off-target LOC100497406
Chr9:2692042..2692064 21/23 Antisense off-target LOC100488698
Chr9:2692042..2692064 21/23 Antisense off-target LOC100487756
Chr9:2692042..2692064 21/23 Antisense off-target LOC100487588
Chr9:2809830..2809852 22/23 Sense unknown
Chr9:2819321..2819343 22/23 Sense unknown
Chr9:4262073..4262095 22/23 Sense unknown
Chr9:5010739..5010761 22/23 Sense unknown
Publications
First: Optimal histone H3 to linker histone H1 chromatin ratio is vital for mesodermal competence in Xenopus., Development 2013                                                
Most recent:
View All Papers