Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249664

Morpholino Name: h3-3a MO1
Synonyms: H3 MO1, h3f3a MO1
Target mRNA: h3-3a

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGTACGGGCCATTTCCCTTTAATCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 23/25
genome
MO
5' CGACTAAAGGGAAATGGCCCGTACC 3'
   ||| |||||||||||||||||||| 
3' GCTAATTTCCCTTTACCGGGCATGT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:12195937..12195961 25/25 Sense off-target h3-5.L
Chr5L:17923201..17923225 24/25 Antisense off-target LOC108716488
Chr4S:62532784..62532808 21/25 Antisense unknown
Chr4S:62535347..62535371 21/25 Antisense unknown
tropicalis 10.0 Chr5:8210005..8210029 23/25 Sense target h3-3a
Publications
First: Optimal histone H3 to linker histone H1 chromatin ratio is vital for mesodermal competence in Xenopus., Development 2013                                                
Most recent:
View All Papers