Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249643

Morpholino Name: rack1 MO2
Synonyms: gnb2l1 MO2
Target mRNA: rack1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGAAACCGCTCCACCGACTAAGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 22/25 25/25
genome
MO
5' TCCTTTGCCGGTGGAGCGGTTTCGG 3'
   ||||| | ||||||||||||||| |
3' AGGAATCAGCCACCTCGCCAAAGTC 5'
5' TCCTTAGTCGGTGGAGCGGTTTCAG 3'
   |||||||||||||||||||||||||
3' AGGAATCAGCCACCTCGCCAAAGTC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:63370821..63370845 25/25 Sense target rack1.L
tropicalis 10.0 Chr8:71560350..71560374 22/25 Sense target rack1
Publications
First: RACK1 is a novel interaction partner of PTK7 that is required for neural tube closure., Development 2011      
Most recent:
View All Papers