Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249642

Morpholino Name: rack1 MO1
Synonyms: RACK1 MO1, gnb2l1 MO1
Target mRNA: rack1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCGAAGTGTCATTTGCTCAGTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGACTGAGCAAATGACACTTCGGG 3'
   |||||||||||||||||||||||||
3' TACTGACTCGTTTACTGTGAAGCCC 5'
5' ATGACTGAGCAAATGACACTTCGGG 3'
   |||||||||||||||||||||||||
3' TACTGACTCGTTTACTGTGAAGCCC 5'
5' ATGACTGAGCAAATGACACTTCGGG 3'
   |||||||||||||||||||||||||
3' TACTGACTCGTTTACTGTGAAGCCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:63370783..63370807 25/25 Sense target rack1.L
Chr8S:80060348..80060372 25/25 Sense target rack1.S
Chr8L:17388432..17388456 24/25 Sense off-target nek6.L
Chr2L:143307616..143307640 24/25 Sense unknown
tropicalis 10.0 Chr8:71560312..71560336 25/25 Sense target rack1
Chr2:35494644..35494668 21/25 Sense off-target dph1
Publications
First: RACK1 is a novel interaction partner of PTK7 that is required for neural tube closure., Development 2011      
Most recent:
View All Papers