Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249612

Morpholino Name: gata5 MO3
Synonyms: GATA5 MO
Target mRNA: gata5

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTACAAACCTCACAGCTCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 20/20 20/20
genome
MO
5' GGAGCTGTGAGGTTTGTAGC 3'
   ||||||||||||||||||||
3' CCTCGACACTCCAAACATCG 5'
5' GGAGCTGTGAGGTTTGTAGC 3'
   ||||||||||||||||||||
3' CCTCGACACTCCAAACATCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:13239529..13239548 20/20 Antisense target gata5.S
Chr9_10L:14596793..14596812 20/20 Antisense target gata5.L
Chr9_10L:14596793..14596812 20/20 Antisense off-target LOC108700924
Chr1S:80137094..80137113 18/20 Sense off-target adgrl3.S
Chr4S:21116320..21116339 16/20 Sense off-target nav2.S
Chr5S:98160890..98160909 16/20 Sense off-target pld1.S
Chr6L:124148573..124148592 16/20 Antisense off-target fam110b.L
Chr2L:37999152..37999171 16/20 Antisense unknown
Chr2S:1504400..1504419 16/20 Sense unknown
tropicalis 10.0 Chr8:146586964..146586983 17/20 Sense off-target gon4l
Chr9:88582931..88582950 16/20 Antisense off-target eaf2
Chr8:70700734..70700753 16/20 Antisense off-target LOC100485719
Publications
First: GATA4, 5 and 6 mediate TGFbeta maintenance of endodermal gene expression in Xenopus embryos., Development 2005            
Most recent: sfrp1 promotes cardiomyocyte differentiation in Xenopus via negative-feedback regulation of Wnt signalling., Development 2013                                      
View All Papers