Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249607

Morpholino Name: gata4 MO2
Synonyms: GATA4 MO, gata4
Target mRNA: gata4

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGGCAACTCAATCCACAAAATCCA 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 21/25 25/25
genome
MO
5' TCGGATCTGTGGATTGAGTTGCCAG 3'
   | |  | ||||||||||||||||||
3' ACCTAAAACACCTAACTCAACGGTC 5'
5' TGGATTTTGTGGATTGAGTTGCCAG 3'
   |||||||||||||||||||||||||
3' ACCTAAAACACCTAACTCAACGGTC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:137100540..137100564 25/25 Sense target gata4.S
Chr5L:162219151..162219175 21/25 Sense target gata4.L
Publications
First: Redundancy and evolution of GATA factor requirements in development of the myocardium., Dev Biol 2007            
Most recent: sfrp1 promotes cardiomyocyte differentiation in Xenopus via negative-feedback regulation of Wnt signalling., Development 2013                                      
View All Papers