Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249562

Morpholino Name: foxo3 MO1
Synonyms: Fox03MO, FoxO3MO
Target mRNA: foxo3

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGCCATGCTGCGAGAAGGGTCTT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AAGACCCTTCTCGCAGCATGGCAGA 3'
   |||||||||||||||||||||||||
3' TTCTGGGAAGAGCGTCGTACCGTCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:81822526..81822550 25/25 Sense target foxo3.L
Chr9_10S:95493189..95493213 21/25 Sense unknown
Publications
First: FoxO genes are dispensable during gastrulation but required for late embryogenesis in Xenopus laevis., Dev Biol 2010                    
Most recent:
View All Papers