Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249556

Morpholino Name: foxj1 MO1
Synonyms: Foxj1MOatg, foxj1, foxj1MO, xFoxJ1 MOATG
Target mRNA: foxj1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGGTCAAACATTAATAAAGCCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' CAGGCTTTATTAATGTTTGACCTGC 3'
     |||||||||||||||||||||||
3' TCCCGAAATAATTACAAACTGGACG 5'
5' AGGGCTTTATTAATGTTTGACCTGC 3'
   |||||||||||||||||||||||||
3' TCCCGAAATAATTACAAACTGGACG 5'
5' AGGGCTTTATTAATGTTTGACCTGC 3'
   |||||||||||||||||||||||||
3' TCCCGAAATAATTACAAACTGGACG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:47682345..47682369 25/25 Sense target foxj1.L
Chr9_10S:40624637..40624661 25/25 Sense target foxj1.S
Chr3S:50468563..50468587 22/25 Antisense off-target fbn1.S
Chr5S:27925694..27925718 21/25 Antisense off-target LOC121394169
Chr6S:98015760..98015784 21/25 Sense unknown
Chr7L:100724270..100724294 21/25 Antisense unknown
tropicalis 10.0 Chr10:45082599..45082623 23/25 Sense target foxj1
Chr5:35644672..35644696 21/25 Antisense unknown
Publications
First: The forkhead protein Foxj1 specifies node-like cilia in Xenopus and zebrafish embryos., Nat Genet 2008                  
Most recent: RNA demethylation by FTO stabilizes the FOXJ1 mRNA for proper motile ciliogenesis., Dev Cell 2021                                    
View All Papers