Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249506

Morpholino Name: fgfr1 MO3
Synonyms: XFGFR1 MO, XFGFR1-MO
Target mRNA: fgfr1

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGGAGAACATCCCAAGTTGGCTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' CTAGCCAACTTGGGATGTTCTCCGG 3'
   |||||||||||||||||||||||||
3' GATCGGTTGAACCCTACAAGAGGCC 5'
5' CTAGCCAACTTGGGATGTTCTCCGG 3'
   |||||||||||||||||||||||||
3' GATCGGTTGAACCCTACAAGAGGCC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:140376378..140376402 25/25 Antisense target fgfr1.L
Chr3S:21946995..21947019 25/25 Sense off-target xfgfra2
Chr2L:42479440..42479464 21/25 Sense unknown
tropicalis 10.0 Chr3:130950294..130950318 25/25 Antisense target fgfr1
Publications
First: Competition for ligands between FGFR1 and FGFR4 regulates Xenopus neural development., Int J Dev Biol 2010            
Most recent:
View All Papers