Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249505

Morpholino Name: fgfr1 MO2
Synonyms: FGFR1b MO
Target mRNA: fgfr1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGGACATTCCGGAGAACATCCCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 24/25
genome
MO
5' TTGGGATGTTCTCCGGAAGGTCCCT 3'
   |||||||||||||||||| ||||||
3' AACCCTACAAGAGGCCTTACAGGGA 5'
5' TTGGGATGTTCTCCGGAAGGTCCCT 3'
   |||||||||||||||||| ||||||
3' AACCCTACAAGAGGCCTTACAGGGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:140376387..140376411 24/25 Antisense target fgfr1.L
Chr3S:21946986..21947010 24/25 Sense off-target xfgfra2
Chr2L:35554759..35554783 21/25 Sense unknown
tropicalis 10.0 Chr3:130950303..130950327 24/25 Antisense target fgfr1
Publications
First: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
Most recent:
View All Papers