Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249504

Morpholino Name: fgfr1 MO1
Synonyms: FGFR1a MO
Target mRNA: fgfr1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGGGACCTTCCGGAGAACATCCCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' TTGGGATGTTCTCCGGAAGGTCCCT 3'
   |||||||||||||||||||||||||
3' AACCCTACAAGAGGCCTTCCAGGGA 5'
5' TTGGGATGTTCTCCGGAAGGTCCCT 3'
   |||||||||||||||||||||||||
3' AACCCTACAAGAGGCCTTCCAGGGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:140376387..140376411 25/25 Antisense target fgfr1.L
Chr3S:21946986..21947010 25/25 Sense off-target xfgfra2
Chr1L:120876830..120876854 21/25 Sense unknown
tropicalis 10.0 Chr3:130950303..130950327 25/25 Antisense target fgfr1
Publications
First: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
Most recent:
View All Papers