Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249503

Morpholino Name: fgf8 MO4
Synonyms: FGF8MO
Target mRNA: fgf8

Morpholino Type: splice blocking morpholino
Sequence: 5' CAATTTACCTGGGCTTGTAGGCAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genome
MO
5' TCTGCCTACAAGCCCAGGTAAATTG 3'
   |||||||||||||||||||||||||
3' AGACGGATGTTCGGGTCCATTTAAC 5'
5' TCTGCCTACAAGCCCAGGTAAAGTG 3'
   |||||||||||||||||||||| ||
3' AGACGGATGTTCGGGTCCATTTAAC 5'
5' TCTGCCTGCAAGCCCAGGTAAATTG 3'
   ||||||| |||||||||||||||||
3' AGACGGATGTTCGGGTCCATTTAAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:26880703..26880727 24/25 Sense target fgf8.L
Chr7S:20500965..20500989 24/25 Sense target fgf8.S
tropicalis 10.0 Chr7:31020788..31020812 25/25 Sense target fgf8
Chr7:86246220..86246244 21/25 Antisense off-target drd2
Publications
First: Reiterative AP2a activity controls sequential steps in the neural crest gene regulatory network., Proc Natl Acad Sci U S A 2011          
Most recent:
View All Papers