Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249502

Morpholino Name: fgf8 MO3
Synonyms: FGF-8-AS, FGF8, FGF8 MO, FGF8-MO
Target mRNA: fgf8

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CCAGGATGGAGGTGATGTAGTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genome
MO
5' ATGAGCTACATCACCTCCATCCTGG 3'
   |||| ||||||||||||||||||||
3' TACTTGATGTAGTGGAGGTAGGACC 5'
5' ATGAACTACATCACCTCCATCCTGG 3'
   |||||||||||||||||||||||||
3' TACTTGATGTAGTGGAGGTAGGACC 5'
5' ATGAGCTACATCACCTCCATCCTGG 3'
   |||| ||||||||||||||||||||
3' TACTTGATGTAGTGGAGGTAGGACC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:26880851..26880875 25/25 Sense target fgf8.L
Chr7S:20501770..20501794 24/25 Sense target fgf8.S
Chr5L:72957587..72957611 21/25 Antisense unknown
tropicalis 10.0 Chr7:31020927..31020951 24/25 Sense target fgf8
Publications
First: Ectopic EphA4 receptor induces posterior protrusions via FGF signaling in Xenopus embryos., Mol Biol Cell 2004                  
Most recent: FGF is essential for both condensation and mesenchymal-epithelial transition stages of pronephric kidney tubule development., Dev Biol 2006                      
View All Papers