Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249501

Morpholino Name: fgf8 MO2
Synonyms: Fgf8aMO, MOSAF8a
Target mRNA: fgf8

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCTGCTCCCTCACATGCTGTGTAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' TTACACAGCATGTGAGGGAGCAGAG 3'
   |||||||||||||||||||||||||
3' AATGTGTCGTACACTCCCTCGTCTC 5'
5' TTACACAGCATGTGAGGGAGCAGAG 3'
   |||||||||||||||||||||||||
3' AATGTGTCGTACACTCCCTCGTCTC 5'
5' TTACACAGCATGTGAGGGAGCAGAG 3'
   |||||||||||||||||||||||||
3' AATGTGTCGTACACTCCCTCGTCTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:26878243..26878267 25/25 Sense target fgf8.L
Chr7S:20499207..20499231 25/25 Sense target fgf8.S
Chr3L:159995584..159995608 22/25 Antisense unknown
tropicalis 10.0 Chr7:31019075..31019099 25/25 Sense target fgf8
Publications
First: FGF8 spliceforms mediate early mesoderm and posterior neural tissue formation in Xenopus., Development 2006              
Most recent: The activity of Pax3 and Zic1 regulates three distinct cell fates at the neural plate border., Mol Biol Cell 2007                  
View All Papers