Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249499

Morpholino Name: fgf4 MO1
Synonyms: FGF4, eFGFMO, eFM, eFM MO
Target mRNA: fgf4

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGGAACAGTCATCCCGATCAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/23 23/23 21/23
genome
MO
5' GTTGATCAGGATGACTGTTCCAT 3'
   ||||||| |||||||||||||||
3' CAACTAGCCCTACTGACAAGGTA 5'
5' GTTGATCGGGATGACTGTTCCAT 3'
   |||||||||||||||||||||||
3' CAACTAGCCCTACTGACAAGGTA 5'
5' GTTGATCAGGATGACTGTTCAAT 3'
   ||||||| |||||||||||| ||
3' CAACTAGCCCTACTGACAAGGTA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:8680384..8680406 23/23 Antisense target fgf4.L
Chr4S:14967939..14967961 21/23 Sense target fgf4.S
Chr3L:28181667..28181689 20/23 Sense off-target LOC121401429
Chr3L:28181667..28181689 20/23 Sense off-target LOC108710837
Chr2S:20323330..20323352 19/23 Sense unknown
tropicalis 10.0 Chr4:12805875..12805897 22/23 Antisense target fgf4
Chr1:151923417..151923439 19/23 Antisense off-target sppl3
Publications
First: eFGF is required for activation of XmyoD expression in the myogenic cell lineage of Xenopus laevis., Development 2002      
Most recent: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
View All Papers