Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249498

Morpholino Name: fgf3 MO1
Synonyms: FGFMO, Fgf3MO
Target mRNA: fgf3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAAATTATAACCATTGTGGCATGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' CCATGCCACAATGGTTATAATTTGG 3'
   |||||||||||||||||||||||||
3' GGTACGGTGTTACCAATATTAAACC 5'
5' CCATGCCACAATGGTTATAATTTGG 3'
   |||||||||||||||||||||||||
3' GGTACGGTGTTACCAATATTAAACC 5'
5' CCATGCCACAATGGTTATAATTTGG 3'
   |||||||||||||||||||||||||
3' GGTACGGTGTTACCAATATTAAACC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:8631965..8631989 25/25 Antisense target fgf3.L
Chr4S:15011999..15012023 25/25 Sense target fgf3.S
Chr6S:103324426..103324450 21/25 Antisense off-target nkain3.S
Chr2S:26847321..26847345 21/25 Antisense off-target LOC108709279
Chr1S:1175356..1175380 21/25 Antisense unknown
Chr3L:150155530..150155554 21/25 Antisense unknown
Chr8L:9610434..9610458 21/25 Sense unknown
tropicalis 10.0 Chr4:12761475..12761499 25/25 Antisense target fgf3
Chr9:30764680..30764704 21/25 Sense off-target mad1l1
Chr5:39773167..39773191 21/25 Antisense off-target LOC100498162
Publications
First: Hindbrain-derived Wnt and Fgf signals cooperate to specify the otic placode in Xenopus., Dev Biol 2008        
Most recent: The forkhead transcription factor FoxB1 regulates the dorsal-ventral and anterior-posterior patterning of the ectoderm during early Xenopus embryogenesis., Dev Biol 2011                
View All Papers