Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249497

Morpholino Name: fgf2 MO1
Synonyms: bFGF-MO
Target mRNA: fgf2

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGTTGTGATGCTCCCTGCCGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genome
MO
5' ATGGCAGCAGGAAGCATCACAACCC 3'
   ||||| ||||| ||||||||||| |
3' TACCGCCGTCCCTCGTAGTGTTGAG 5'
5' ATGGCGGCAGGGAGCATCACAACTC 3'
   |||||||||||||||||||||||||
3' TACCGCCGTCCCTCGTAGTGTTGAG 5'
5' ATGGCGGCAGGGAGCATCACTACTC 3'
   |||||||||||||||||||| ||||
3' TACCGCCGTCCCTCGTAGTGTTGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:69964916..69964940 25/25 Sense target fgf2
Chr1S:54668543..54668567 24/25 Sense target fgf2.S
tropicalis 10.0 Chr1:65959843..65959867 22/25 Sense target fgf2
Chr8:146128405..146128429 21/25 Antisense unknown
Publications
First: Axonal filopodial asymmetry induced by synaptic target., Mol Biol Cell 2011              
Most recent: An in vivo screen to identify candidate neurogenic genes in the developing Xenopus visual system., Dev Biol 2015                      
View All Papers