Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249496

Morpholino Name: fgf13 MO2
Synonyms:
Target mRNA: fgf13

Morpholino Type: uncategorized morpholino
Sequence: 5' AGAGAGCTGGCAATGGCCGCAGCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genome
MO
5' TGGCTGCGGCCATTGCCAGCTCTCT 3'
   |||||||||||||||||||||||||
3' ACCGACGCCGGTAACGGTCGAGAGA 5'
5' TGGCCGCGGCCATTGCCAGCTCTCT 3'
   |||| ||||||||||||||||||||
3' ACCGACGCCGGTAACGGTCGAGAGA 5'
5' TGGCTGCGGCCATTGCCAGCTCTCT 3'
   |||||||||||||||||||||||||
3' ACCGACGCCGGTAACGGTCGAGAGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:78479402..78479426 25/25 Sense target fgf13.S
Chr8L:61767279..61767303 24/25 Sense target fgf13.L
tropicalis 10.0 Chr8:69725333..69725357 25/25 Sense target fgf13
Publications
First: Fibroblast growth factor 13 is essential for neural differentiation in Xenopus early embryonic development., J Biol Chem 2007                  
Most recent:
View All Papers