Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249495

Morpholino Name: fgf13 MO1
Synonyms:
Target mRNA: fgf13

Morpholino Type: uncategorized morpholino
Sequence: 5' TAGGCTTGATCACCTTTCCACTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genome
MO
5' ATGAGTGGAAAGGTGATCAAGCCTA 3'
   |||||||||||||||||||||||||
3' TACTCACCTTTCCACTAGTTCGGAT 5'
5' ATGAGTGGAAAGGTGATCAAGCCTA 3'
   |||||||||||||||||||||||||
3' TACTCACCTTTCCACTAGTTCGGAT 5'
5' ATGAGTGGAAAGGTGATCAAGCCCA 3'
   ||||||||||||||||||||||| |
3' TACTCACCTTTCCACTAGTTCGGAT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:61901850..61901874 25/25 Sense target fgf13.L
Chr8S:78617126..78617150 24/25 Sense target fgf13.S
Chr7L:95225421..95225445 22/25 Antisense off-target cfap74.L
tropicalis 10.0 Chr8:69855352..69855376 25/25 Sense target fgf13
Publications
First: Fibroblast growth factor 13 is essential for neural differentiation in Xenopus early embryonic development., J Biol Chem 2007                  
Most recent:
View All Papers