Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249492

Morpholino Name: fbxo43 MO7
Synonyms: XErp1#6
Target mRNA: fbxo43

Morpholino Type: uncategorized morpholino
Sequence: 5' GGGAATCTGCAAAGCTATTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 20/20 20/20
genome
MO
5' CAATAGCTTTGCAGATTCCC 3'
   ||||||||||||||||||||
3' GTTATCGAAACGTCTAAGGG 5'
5' CAATAGCTTTGCAGATTCCC 3'
   ||||||||||||||||||||
3' GTTATCGAAACGTCTAAGGG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:138137297..138137316 20/20 Sense target fbxo43.L
Chr6S:113991728..113991747 20/20 Sense target fbxo43.S
Chr3L:102230379..102230398 18/20 Sense off-target klf13.L
Chr6L:153281079..153281098 17/20 Antisense off-target asap1.L
Chr9_10L:85426101..85426120 17/20 Antisense off-target erbb4.L
Chr2L:128453394..128453413 16/20 Antisense off-target LOC108708487
Chr5S:90355893..90355912 19/20 Sense unknown
Chr6S:100889650..100889669 17/20 Antisense unknown
Chr2S:154020786..154020805 16/20 Antisense unknown
Chr5L:161030509..161030528 16/20 Antisense unknown
Chr5S:135988822..135988841 16/20 Antisense unknown
tropicalis 10.0 Chr1:17052906..17052925 17/20 Antisense off-target rab11fip5
Chr8:130072326..130072345 17/20 Antisense off-target LOC100488012
Chr4:146238525..146238544 16/20 Antisense off-target LOC116410283
Chr9:85142740..85142759 16/20 Antisense off-target LOC116407773
Chr6:82012938..82012957 16/20 Sense unknown
Chr2:57431742..57431761 16/20 Antisense unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent:
View All Papers