Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249490

Morpholino Name: fbxo43 MO5
Synonyms: XErp1#4
Target mRNA: fbxo43

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTAGAAATGAGCAGCCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
MO
5' GAAGGCTGCTCATTTCTAAA 3'
   ||||||||||||||||||||
3' CTTCCGACGAGTAAAGATTT 5'
5' GAAGGCTGCTCATTTCTAAA 3'
   ||||||||||||||||||||
3' CTTCCGACGAGTAAAGATTT 5'
5' GAAGGCTGCTCATTTCTAAA 3'
   ||||||||||||||||||||
3' CTTCCGACGAGTAAAGATTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:138137424..138137443 20/20 Sense target fbxo43.L
Chr6S:113991855..113991874 20/20 Sense target fbxo43.S
Chr1S:145084054..145084073 18/20 Sense off-target galnt9.S
Chr2S:45164808..45164827 18/20 Sense off-target LOC108709394
Chr5L:167472754..167472773 17/20 Antisense unknown
Chr6L:106813828..106813847 16/20 Sense unknown
tropicalis 10.0 Chr6:128123957..128123976 20/20 Sense target fbxo43
Chr1:132029720..132029739 17/20 Sense off-target prune2
Chr2:170006942..170006961 16/20 Antisense off-target tenm4
Chr5:126749823..126749842 18/20 Antisense unknown
Chr1:136607897..136607916 17/20 Sense unknown
Chr6:127477221..127477240 17/20 Sense unknown
Chr1:88247578..88247597 16/20 Antisense unknown
Chr5:30911503..30911522 16/20 Antisense unknown
Chr8:102598630..102598649 16/20 Antisense unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent:
View All Papers