Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249489

Morpholino Name: fbxo43 MO4
Synonyms: XErp1#3
Target mRNA: fbxo43

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGCTTGGATTCCCTTGTGTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/22 22/22 22/22
genome
MO
5' AGATACAAGGGAATCCAAGCAG 3'
   ||| ||||||||||||||||||
3' TCTGTGTTCCCTTAGGTTCGTC 5'
5' AGACACAAGGGAATCCAAGCAG 3'
   ||||||||||||||||||||||
3' TCTGTGTTCCCTTAGGTTCGTC 5'
5' AGACACAAGGGAATCCAAGCAG 3'
   ||||||||||||||||||||||
3' TCTGTGTTCCCTTAGGTTCGTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:138137499..138137520 22/22 Sense target fbxo43.L
Chr6S:113991930..113991951 22/22 Sense target fbxo43.S
Chr4L:121049317..121049338 21/22 Sense off-target cdc42ep1.L
Chr3L:90212073..90212094 20/22 Antisense off-target rbm17.L
Chr6L:13144391..13144412 20/22 Antisense off-target galnt11.L
Chr3L:118021418..118021439 20/22 Sense off-target slco3a1.L
Chr6S:9009932..9009953 20/22 Antisense off-target galnt11.S
Chr6L:13115749..13115770 20/22 Antisense off-target LOC121394528
Chr9_10S:62025907..62025928 19/22 Sense off-target pkp4.S
Chr1L:27864505..27864526 19/22 Antisense off-target slc2a15a.L
Chr4L:18067799..18067820 19/22 Antisense off-target LOC108713463
Chr1S:28204011..28204032 18/22 Antisense off-target fryl.S
Chr6S:124055530..124055551 18/22 Antisense off-target mal2.S
Chr7L:63896105..63896126 18/22 Antisense off-target dtx4.L
Chr2L:111682133..111682154 18/22 Sense off-target dmd.1.L
Chr6S:48748993..48749014 18/22 Sense off-target LOC108719696
Chr2L:75286726..75286747 20/22 Antisense unknown
Chr8S:44431973..44431994 20/22 Antisense unknown
Chr9_10S:94568122..94568143 20/22 Antisense unknown
Chr1L:69264870..69264891 19/22 Sense unknown
Chr1S:78999061..78999082 19/22 Antisense unknown
Chr1S:79009105..79009126 19/22 Antisense unknown
Chr2S:54663563..54663584 19/22 Antisense unknown
Chr2S:54799075..54799096 19/22 Antisense unknown
Chr2S:54811877..54811898 19/22 Antisense unknown
Chr2S:55089611..55089632 19/22 Antisense unknown
Chr4L:34493759..34493780 19/22 Sense unknown
Chr4S:25246682..25246703 19/22 Sense unknown
Chr5L:63288338..63288359 19/22 Antisense unknown
Chr5L:63321061..63321082 19/22 Antisense unknown
Chr6L:78585703..78585724 19/22 Antisense unknown
Chr6L:78594287..78594308 19/22 Antisense unknown
Chr3L:156108770..156108791 19/22 Sense unknown
Chr3L:19236873..19236894 19/22 Sense unknown
Chr6S:53043503..53043524 19/22 Sense unknown
Chr7L:137603028..137603049 19/22 Sense unknown
Chr7S:111640528..111640549 19/22 Sense unknown
Chr7S:47587033..47587054 19/22 Antisense unknown
Chr8L:10717782..10717803 19/22 Antisense unknown
Chr8L:21918111..21918132 19/22 Antisense unknown
Chr8S:49164807..49164828 19/22 Antisense unknown
Chr8S:49195226..49195247 19/22 Sense unknown
Chr9_10S:25133787..25133808 19/22 Sense unknown
Chr6L:78634626..78634647 18/22 Antisense unknown
Chr7L:28051348..28051369 18/22 Sense unknown
Chr8L:10023228..10023249 18/22 Sense unknown
Chr8L:10772088..10772109 18/22 Antisense unknown
tropicalis 10.0 Chr6:128124032..128124053 21/22 Sense target fbxo43
Chr4:123465137..123465158 20/22 Antisense off-target cacng2
Chr2:39101484..39101505 19/22 Antisense off-target LOC101732217
Chr3:111998700..111998721 18/22 Sense off-target slco3a1
Chr3:39342379..39342400 19/22 Sense unknown
Chr4:16677067..16677088 19/22 Antisense unknown
Chr4:42238725..42238746 19/22 Sense unknown
Chr5:27218457..27218478 19/22 Antisense unknown
Chr5:90152257..90152278 19/22 Sense unknown
Chr3:134455229..134455250 18/22 Antisense unknown
Chr4:31714777..31714798 18/22 Sense unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent:
View All Papers