Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249482

Morpholino Name: fam3c MO1
Synonyms: XFAM3C MO
Target mRNA: fam3c

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTTATGGCACCTGCTATCCTCATG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:70476971..70476995 21/25 Sense off-target katnb1.L
Chr9_10L:62809595..62809619 21/25 Antisense unknown
Chr9_10S:54169930..54169954 21/25 Antisense unknown
Publications
First: Secreted factor FAM3C (ILEI) is involved in retinal laminar formation., Biochem Biophys Res Commun 2010            
Most recent:
View All Papers