Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249480

Morpholino Name: f2rl1 MO1
Synonyms: PAR-2
Target mRNA: f2rl1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCTCCAGACACCCATGTCCTTTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 21/25 24/25
genome
MO
5' GGAAAGGACATGGGGGACTGGCGGT 3'
   |||||||||||||| | |||| || 
3' CCTTTCCTGTACCCACAGACCTCCG 5'
5' GGAAAGGACATGGGTGGCTGGAGGC 3'
   |||||||||||||||| ||||||||
3' CCTTTCCTGTACCCACAGACCTCCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:173099655..173099679 24/25 Antisense target f2rl1.S
Chr1S:173178087..173178111 24/25 Antisense off-target LOC108707269
Chr6L:22905782..22905806 21/25 Sense off-target LOC108718771
Chr8L:120537077..120537101 21/25 Antisense off-target LOC108699099
Chr7S:26824430..26824454 21/25 Sense unknown
tropicalis 10.0 Chr1:184883553..184883577 21/25 Antisense target f2rl1
Publications
First: Indirect activation of the epithelial Na+ channel by trypsin., J Biol Chem 2007  
Most recent:
View All Papers