Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249463

Morpholino Name: hes5.5 MO1
Synonyms: esr10, esr10 MO1
Target mRNA: hes5.5

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGTTTAGTAAGTGGATATGATGGA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 24/25
genome
MO
5' TCCATCACATCCACTTACTAAACAG 3'
   ||||||| |||||||||||||||||
3' AGGTAGTATAGGTGAATGATTTGTC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:86996561..86996585 24/25 Antisense target hes5.5.S
Chr7S:87003465..87003489 24/25 Antisense off-target hes5.6.S
Chr7S:87013412..87013436 23/25 Antisense off-target hes5.7.S
Chr5L:104539353..104539377 21/25 Sense unknown
tropicalis 10.0 Chr1:10084882..10084906 21/25 Antisense unknown
Publications
First: The Notch-effector HRT1 gene plays a role in glomerular development and patterning of the Xenopus pronephros anlagen., Development 2006                    
Most recent:
View All Papers