Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249408

Morpholino Name: ripply3 MO1
Synonyms: Ripply3 #1, dscr6 MO1
Target mRNA: ripply3

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGACAGACCCTGAAGCTGTGGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 24/25 25/25
genome
MO
5' AGCCACAGCTTCAGGGTCTGTCCCA 3' |||||||||||||||||||||| 3' TCGGTGTCGAAGTCCCAGACAGACA 5' 5' AGCCGCAGCTTCAGGGTCTGTCTGT 3' |||| |||||||||||||||||||| 3' TCGGTGTCGAAGTCCCAGACAGACA 5' 5' AGCCACAGCTTCAGGGTCTGTCTGT 3' ||||||||||||||||||||||||| 3' TCGGTGTCGAAGTCCCAGACAGACA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:21562931..21562955 25/25 Antisense target ripply3.S
Chr2L:12110192..12110216 24/25 Antisense target ripply3.L
Chr2S:162700064..162700088 21/25 Antisense off-target LOC108710034
Chr9_10L:135419797..135419821 22/25 unknown
tropicalis 10.0 Chr2:12667789..12667813 22/25 Antisense target ripply3
Publications
First: RIPPLY3 is a retinoic acid-inducible repressor required for setting the borders of the pre-placodal ectoderm., Development 2012                          
Most recent: The regulatory proteins DSCR6 and Ezh2 oppositely regulate Stat3 transcriptional activity in mesoderm patterning during Xenopus development., J Biol Chem 2020                  
View All Papers