Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249390

Morpholino Name: dmrta2 MO1
Synonyms: Dmrt5
Target mRNA: dmrta2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCATTCAGCTCCATTGTACAGTTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 22/25 24/25
genome
MO
5' CGATTGTAGAATGGAGCTGAATGGT 3'
   | | |||| ||||||||||||||||
3' GTTGACATGTTACCTCGACTTACCA 5'
5' CAACTCTACAATGGAGCTGAATGGT 3'
   ||||| |||||||||||||||||||
3' GTTGACATGTTACCTCGACTTACCA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4S:75906100..75906124 24/25 Sense target dmrta2.S
Chr4L:91061325..91061349 22/25 Sense target dmrta2.L
Chr9_10L:77164591..77164615 21/25 Antisense off-target ola1.L
Chr3S:80295739..80295763 22/25 Sense unknown
tropicalis 10.0 Chr1:207512054..207512078 22/25 Antisense off-target setbp1
Publications
First: The Xenopus doublesex-related gene Dmrt5 is required for olfactory placode neurogenesis., Dev Biol 2013                                
Most recent:
View All Papers