Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249388

Morpholino Name: dlx3 MO2
Synonyms: Dlx3-mo
Target mRNA: dlx3

Morpholino Type: uncategorized morpholino
Sequence: 5' ATAGTTTATTACCTGCGTCTGAGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genome
MO
5' CACTCAAACGCAGGTAATAAACCAT 3'
   |||||| ||||||||||||||| ||
3' GTGAGTCTGCGTCCATTATTTGATA 5'
5' CACTCAGACGCAGGTAATAAACTAT 3'
   |||||||||||||||||||||||||
3' GTGAGTCTGCGTCCATTATTTGATA 5'
5' CACTCAGACGCAGGTAATAAACTAT 3'
   |||||||||||||||||||||||||
3' GTGAGTCTGCGTCCATTATTTGATA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:4805991..4806015 25/25 Sense target dlx3.L
Chr9_10S:4541673..4541697 25/25 Sense target dlx3.S
tropicalis 10.0 Chr10:14665803..14665827 23/25 Sense target dlx3
Chr2:120417983..120418007 21/25 Antisense off-target tmtc4
Publications
First: Specification of the otic placode depends on Sox9 function in Xenopus., Development 2004                
Most recent:
View All Papers