Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249384

Morpholino Name: dll1 MO1
Synonyms: Delta1 MO
Target mRNA: dll1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCTGCTGTCCCATGTTGTCTGATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genome
MO
5' TATCAGCCAACATGGGACAGCAATG 3'
   |||||| |||||||||||||||  |
3' ATAGTCTGTTGTACCCTGTCGTCGC 5'
5' TATCAGACAACATGGGACAGCAGCG 3'
   |||||||||||||||||||||||||
3' ATAGTCTGTTGTACCCTGTCGTCGC 5'
5' TATCAGCCAACATGGGACAGCAGTG 3'
   |||||| |||||||||||||||| |
3' ATAGTCTGTTGTACCCTGTCGTCGC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:51457114..51457138 25/25 Sense target dll1.L
Chr5S:41712299..41712323 23/25 Sense target dll1.S
Chr2L:104484572..104484596 21/25 Sense off-target gtf2ird1.L
tropicalis 10.0 Chr5:50495476..50495500 22/25 Sense target dll1
Publications
First: Hairy2 functions through both DNA-binding and non DNA-binding mechanisms at the neural plate border in Xenopus., Dev Biol 2008                          
Most recent: Self-regulation of Stat3 activity coordinates cell-cycle progression and neural crest specification., EMBO J 2010  
View All Papers