Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249379

Morpholino Name: dicer1 MO4
Synonyms: Dicer MO2
Target mRNA: dicer1

Morpholino Type: uncategorized morpholino
Sequence: 5' GAGTCATGAGCTGAAGGCCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genome
MO
5' ATGGCAGGCCTTCAGCTCATGACTC 3'
   |||||||||||||||||||||||||
3' TACCGTCCGGAAGTCGAGTACTGAG 5'
5' ATGGCAGGACTTCAGCTCATGACTC 3'
   |||||||| ||||||||||||||||
3' TACCGTCCGGAAGTCGAGTACTGAG 5'
5' ATGGCAGGCCTTCAGCTCATGACTC 3'
   |||||||||||||||||||||||||
3' TACCGTCCGGAAGTCGAGTACTGAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:19864849..19864873 25/25 Antisense target dicer1.S
Chr8L:79500544..79500568 24/25 Sense target dicer1.L
tropicalis 10.0 Chr8:88609159..88609183 25/25 Sense target dicer1
Chr5:41326157..41326181 21/25 Sense unknown
Publications
First: FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development., Dev Biol 2010                                                                
Most recent:
View All Papers