Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249378

Morpholino Name: dicer1 MO3
Synonyms: Dicer MO1
Target mRNA: dicer1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGCCTGCCATGCTGAGGGTCTGCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genome
MO
5' TTGCAGACCCTCAGCATGGCAGGCC 3'
   |||||||||||||||||||||||||
3' AACGTCTGGGAGTCGTACCGTCCGG 5'
5' TTGCAGTCCCTCAGCATGGCAGGAC 3'
   |||||| |||||||||||||||| |
3' AACGTCTGGGAGTCGTACCGTCCGG 5'
5' TTGCAGACCCTCAGCATGGCAGGCC 3'
   |||||||||||||||||||||||||
3' AACGTCTGGGAGTCGTACCGTCCGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:19864834..19864858 25/25 Antisense target dicer1.S
Chr8L:79500559..79500583 23/25 Sense target dicer1.L
Chr9_10L:61967436..61967460 22/25 Antisense off-target dnajb2.L
Chr2L:168579141..168579165 21/25 Antisense off-target yap1.L
Chr1L:175815805..175815829 21/25 Sense off-target mlxip.L
Chr3S:124153915..124153939 21/25 Sense off-target kank2.S
Chr6L:88042900..88042924 21/25 Sense unknown
tropicalis 10.0 Chr8:88609174..88609198 25/25 Sense target dicer1
Publications
First: FMR1/FXR1 and the miRNA pathway are required for eye and neural crest development., Dev Biol 2010                                                                
Most recent:
View All Papers