Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249377

Morpholino Name: dicer1 MO2
Synonyms: xdcr-mo2
Target mRNA: dicer1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATGAAGATCCTCTGATGGCACTTGA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' TCAAGTGCCATCAGAGGATCTTCAT 3'
   |||||||||||||||||||||||||
3' AGTTCACGGTAGTCTCCTAGAAGTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:19862506..19862530 25/25 Antisense target dicer1.S
Publications
First: Dicer inactivation causes heterochronic retinogenesis in Xenopus laevis., Int J Dev Biol 2008                  
Most recent:
View All Papers