Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249374

Morpholino Name: dhrs3 MO1
Synonyms: DHRS3
Target mRNA: dhrs3

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGTTCTGTCAGCCCTGTGCACTCAT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Dhrs3 protein attenuates retinoic acid signaling and is required for early embryonic patterning., J Biol Chem 2013                      
Most recent:
View All Papers